RegulonDB RegulonDB 11.0: Gene Sequence
cspE gene sequence


Size: 210        A: 61  T: 57  G: 48  C: 44

Fasta

 

>cspE E. coli K12. Version NC_000913.3 GI:556503834
atgtctaagattaaaggtaacgttaagtggtttaatgagtccaaaggattcggtttcatt
actccggaagacggcagcaaagacgtgttcgtacacttctctgcaatccagactaatggt
tttaaaactcttgctgaaggtcagcgcgtagagttcgaaatcactaacggtgccaaaggc
ccttctgctgcaaacgtaatcgctctgtaa
              
                            

Download fasta file
RegulonDB