RegulonDB RegulonDB 10.10: Gene Sequence
grxD gene sequence


Size: 348        A: 90  T: 75  G: 94  C: 89

Fasta

 

>grxD E. coli K12. Version NC_000913.3 GI:556503834
atgagcaccactatcgaaaaaatccaacgccagattgctgaaaacccgatcctgctgtac
atgaaaggttcaccgaaactgccgagctgcggtttctctgcccaggcagtccaggcgctt
gccgcatgtggcgaacgttttgcctatgttgatattctgcagaatccggacattcgtgcg
gaactgccgaaatatgctaactggccgaccttcccgcaactgtgggttgacggcgagctg
gtcggcggttgtgatatcgtgatcgaaatgtatcagcgtggcgaactgcagcagctgatc
aaagaaactgccgctaaatacaagtctgaagagccggacgcggaataa
              
                            

Download fasta file
RegulonDB