RegulonDB RegulonDB 10.8: Gene Sequence
hemF gene sequence


Size: 900        A: 189  T: 219  G: 261  C: 231

Fasta

 

>hemF E. coli K12. Version NC_000913.3 GI:556503834
atgaaacccgacgcacaccaggttaaacagtttctgctcaaccttcaggatacgatttgt
cagcagctgaccgccgtcgatggcgcagaatttgtcgaagatagttggcagcgcgaagct
ggcggcggcgggcgtagtcgggtgttgcgtaatggtggtgttttcgaacaggcaggcgtc
aacttttcgcatgtccacggtgaggcgatgcctgcttccgccaccgctcatcgcccggaa
cttgccgggcgcagtttcgaggcgatgggcgtttcactggtagtgcatccgcataacccg
tatgttcccaccagccacgcgaatgtgcggttttttattgccgaaaaaccgggtgccgat
cccgtctggtggtttggcggtggcttcgacttaaccccattctatggttttgaagaagat
gctattcactggcatcgcaccgcccgtgacctgtgcctgccatttggcgaagacgtttat
ccccgttacaaaaagtggtgcgacgaatacttctacctcaaacatcgcaacgaacagcgc
ggtattggcgggctgttctttgatgacctgaacacgccagatttcgaccgctgttttgcc
tttatgcaggcggtaggcaaaggctacaccgacgcttatttaccaattgtcgagcgacgg
aaagcgatggcctacggcgagcgcgagcgcaatttccagttatatcgtcgcggtcgttat
gtcgagttcaatctggtctgggatcgcggcacgctgtttggcctgcaaactggcgggcgc
accgagtctatcctgatgtcaatgccgccactggtacgctgggaatatgattatcagcca
aaagatggcagcccagaagcggcgttaagtgagtttattaaggtcagggattgggtgtaa
              
                            

Download fasta file
RegulonDB