RegulonDB RegulonDB 10.8: Gene Sequence
cbpA gene sequence


Size: 921        A: 246  T: 188  G: 253  C: 234

Fasta

 

>cbpA E. coli K12. Version NC_000913.3 GI:556503834
atggaattaaaggattattacgccatcatgggcgtgaaaccgacggacgatctcaagaca
atcaagaccgcctatcgtcgacttgcccgcaaataccatcctgatgtcagcaaagaaccg
gatgccgaagcccgcttcaaagaggtcgctgaagcctgggaagtgttaagtgatgaacaa
cgtcgcgctgagtatgatcagatgtggcaacatcgcaacgatccgcaatttaaccgtcag
ttccaccatggcgacggtcagagttttaacgccgaagattttgacgatatcttctcgtca
attttcggtcagcatgcccgccagagccgtcaacgccccgccacacgcggccacgatatt
gaaatcgaagtggcggtattcctcgaagaaacgcttactgagcataagcgtaccatcagc
tataacctgccggtttataacgcctttggcatgatcgaacaggaaattccgaaaacgctg
aatgtgaagatcccggcgggcgtcggcaatggtcaacgcatccgtctgaaaggccagggg
acgccgggcgaaaacggcggtccaaatggcgatttgtggctggtgattcatattgcgcca
catccgctgtttgatattgtcggccaggatctggaaattgtggtgccggttagcccgtgg
gaagcggcgctgggtgctaaagtcaccgttccaacactgaaagaaagcattttgctgact
atcccgccaggcagccaggccgggcaacgattgcgcgttaaaggcaaaggtctggtgagc
aaaaaacagaccggcgatctgtatgcggtactgaaaatcgtgatgccgccgaaaccggat
gaaaacactgccgcgctgtggcagcaactggcagacgcccagtcgtcttttgatccacgt
aaagattgggggaaagcataa
              
                            

Download fasta file
RegulonDB