RegulonDB RegulonDB 10.9: Gene Sequence
torD gene sequence


Size: 600        A: 145  T: 135  G: 172  C: 148

Fasta

 

>torD E. coli K12. Version NC_000913.3 GI:556503834
atgaccacgctgacagcacaacagattgcctgtgtttacgcctggctagcgcagttgttc
tcccgtgagctggacgatgaacaactgacgcaaatcgccagtgcgcagatggctgaatgg
ttttcgttgctgaaaagcgaaccgccgctcactgcggcggtgaacgagctggaaaaccgt
attgccacgctgacagtacgtgacgatgcccgtctggaactggccgcggacttttgcggc
ctgtttctgatgaccgacaaacaagcggcgctgccgtatgcatcggcctacaaacaggac
gagcaagagattaaacgcttgttagttgaggcagggatggaaaccagcggcaatttcaac
gaaccggcagatcatctggcgatctatctcgaattgctcagccatctgcatttttcgctg
ggagaggggaccgttcctgcgcgaagaatcgacagtttgcggcaaaaaacactgacggcg
ctgtggcaatggttaccagagtttgttgcgcgttgtcgtcagtatgacagctttggtttt
tacgcggcactaagccagttattgctggtgttagtggagtgcgaccaccaaaacagataa
              
                            

Download fasta file
RegulonDB