RegulonDB RegulonDB 10.9: Gene Sequence
yccE gene sequence


Size: 1257        A: 414  T: 414  G: 253  C: 176

Fasta

 

>yccE E. coli K12. Version NC_000913.3 GI:556503834
atgggtagtaatatacatggaattagttgcactgcaaataattatttgaaacaggcctgg
aacgatataaaaaatgagtacgaaaaaaatcaaacatattcaatcacgctttttgaaaac
acactggtgtgttttatgcggttatacaatgaactcagacgtaaagtaaatgaagaggat
actccatgtctggaatgtgaatcactagaaaaagaatttgaggaaatgcagaatgataat
gatctatcattatttatgagaatattgcgtactaatgatacacaaatttattcaggggtt
tcaggaggtattacatatactatacaatatgttcgagatattgatattgttagagtgtcc
ttgccgggcagagcttcagagtctatcacagattttaaaggttattattggtataacttt
atggagtatattgaaaacattaatgcgtgtgatgatgttttttctgagtattgttttgat
gatgaaaatataagtgtccagccagagcggataaatacgccgggaatatctgatttggat
tctgacattgatttgtctggtatatcttttattcagcgtgaaactaaccaggcattagga
ttaaaatatgctcctgtagatggcgatggatattgtctgttaagagctatactggtttta
aaacaacatgattattcatgggcgctggtcagttataagatgcaaaaggaagtttacaac
gaattcattaaaatggttgataaaaaaacgatcgaggctcttgttgatacggcattctat
aatctcagggaagatgtaaagacgttatttggcgttgatctacaatctgacaaccaaatt
caggggcagagtagtcttatgtcatggagctttctgttttttaaaaaacaattcattgat
agttgcttgaataacgaaaaatgtatcctgcatttacccgagtttatatttaatgataac
aagaacttgcttgctttagataccgacacgtcggataggattaaagcggtgaagaatttt
cttgttgttctttcagatagcatttgctcattatttattgttaatagtaatgtggcatca
atctccttggggaatgaatccttttcaacagatgaagatcttgagtatggttatttaatg
aacactggcaatcattatgacgtttacctccctcctgaactttttgctcaggcttacaag
ttaaacaataaggaaatgaatgcgcaactcgactatttaaatcgttatgcaatttaa
              
                            

Download fasta file
RegulonDB