RegulonDB RegulonDB 11.1: Gene Sequence
chbG gene sequence


Size: 750        A: 160  T: 204  G: 228  C: 158

Fasta

 

>chbG E. coli K12. Version NC_000913.3 GI:556503834
atggaacgcttactgattgttaatgccgatgattttggcttaagcaaaggtcagaactac
ggcattatcgaggcctgtcgcaatgggattgtcacgtcgacgacggcgctggtgaatggg
caggctattgaccatgcggtgcagttgagtcgtgatgaaccgagtctggccatagggatg
cactttgtccttactatgggtaagccactgacagctatgccggggttaacccgcgatggt
gtgctgggaaaatggatctggcagttggcagaagaagatgctttaccgctggaagaaatt
actcaggagcttgtcagtcagtatttgcgtttcattgagctatttggacgcaaacctacg
catcttgatagccatcatcatgtgcatatgttcccgcagattttcccgattgttgccagg
tttgcggcagagcagggcattgcgttgcgggcggatcgtcagatggcgtttgatttgccg
gtcaacctgcgcactacccagggattcagcagtgcattctacggtgaagagatcagtgag
tcgctgttcctgcaagtgctggatgacgcaggccatcggggtgatcgttcgctggaggtg
atgtgtcatccggcgtttatcgataatactatccgtcagagtgcttactgtttcccacgc
ttaacggagctggatgtgttgacatcagcgtcgttgaaaggtgctatcgctcagcgtggt
tatcggttggggagttatcgggatgtgtaa
              
                            

Download fasta file
RegulonDB