RegulonDB RegulonDB 10.9: Gene Sequence
yegD gene sequence


Size: 1353        A: 303  T: 291  G: 420  C: 339

Fasta

 

>yegD E. coli K12. Version NC_000913.3 GI:556503834
gtgtttattggttttgattacggtacagcaaactgttcagtggcggtcatgcgtgacggt
aaaccgcatttgctaaaaatggaaaacgacagcacgctgctgccttcaatgctttgcgcg
ccaacgcgtgaagcggtaagcgaatggctgtaccgccatcatgatgttccggcagacgac
gatgaaacgcaggcgctgttacgtcgggcgattcgttataaccgcgaagaagatatcgat
gttacggcgaaaagcgtgcagttcggtctttcctcactggcacagtacattgatgatcca
gaagaagtgtggtttgtgaaatcaccaaaatcgttcctcggtgccagcggcttaaaaccg
cagcaggtagcgctgtttgaggatctggtctgcgcaatgatgttgcacattcgccagcag
gcgcaggcacagctgccagaagcgattactcaggcggtgattggtcgtccgatcaacttc
caggggctgggcggtgatgaagcaaacacccaggcgcaagggattctggaacgcgcggcg
aagcgtgccggattcagggacgtggtattccagtacgagccggtcgcggctgggctggat
tacgaagccaccttgcaggaagaaaaacgggtgctggtggtggatatcggcggtggtacg
actgactgttcattgctgctgatggggccgcagtggcgttcgcgtctcgatcgtgaagcc
agcctgctgggtcacagtggttgccgtattggcggtaacgatctggatatcgcgctggcg
tttaaaaacctgatgccactgctgggtatgggtggcgaaaccgaaaaaggcatcgccctg
ccgatcctgccgtggtggaatgcggttgccatcaacgacgtacctgcgcagagtgatttc
tacagtagtgccaacggtcgtctgcttaacgatctggtacgcgatgcccgcgaaccggaa
aaagtggccctgttacagaaagtctggcgtcagcgtttaagctatcgcctggtgcgtagc
gcagaagagtgcaaaattgctctttcaagcgtagcggaaacccgcgcctcactgccgttt
atcagcaatgaactggctacgctgattagccagcgagggctggaaagcgccctcagccag
ccactgacgcggattctggaacaggtgcaactggccctggataacgcccaggaaaaaccg
gacgttatctacctgaccggcggtagcgcccgttctccgctgattaaaaaagcgctggca
gaacagttgccgggcattccgattgcaggcggcgatgactttggctccgtcaccgccggg
ctggcacgctgggcggaagtggtgtttcgttaa
              
                            

Download fasta file
RegulonDB