RegulonDB RegulonDB 10.9: Gene Sequence
ygaC gene sequence


Size: 345        A: 89  T: 94  G: 87  C: 75

Fasta

 

>ygaC E. coli K12. Version NC_000913.3 GI:556503834
atgtatttacgaccagacgaggtggcgcgcgtacttgaaaaagtcggttttactgtcgat
gtggtaacccagaaagcgtatggttaccgccgtggggaaaattatgtctatgttaatcgc
gaagcgcgaatgggacgtaccgctctggtaattcatccaacattaaaagaacgcagttcg
acactggctgaacccgcttccgatattaaaacttgcgatcattaccagcaatttccgctc
tatttagcaggcgagcgacacgagcattacggtatcccgcatggctttagttcgcgtgtt
gcgcttgaacgttatttgaatggtttatttggcgaagccagttaa
              
                            

Download fasta file
RegulonDB