RegulonDB RegulonDB 10.9: Gene Sequence
cspB gene sequence


Size: 216        A: 64  T: 76  G: 46  C: 30

Fasta

 

>cspB E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaataaaatgactggtttagtaaaatggtttaacgctgataaaggtttcggcttt
atttctcctgttgatggtagtaaagatgtgtttgtgcatttttctgcgattcagaatgat
aattatcgaaccttatttgaaggtcaaaaggttaccttctctatagagagtggtgctaaa
ggtcctgcagcagcaaatgtcatcattactgattaa
              
                            

Download fasta file
RegulonDB