RegulonDB RegulonDB 10.9: Gene Sequence
cspC gene sequence


Size: 210        A: 58  T: 54  G: 56  C: 42

Fasta

 

>cspC E. coli K12. Version NC_000913.3 GI:556503834
atggcaaagattaaaggtcaggttaagtggttcaacgagtctaaaggttttggcttcatt
actccggctgatggcagcaaagatgtgttcgtacacttctccgctatccagggtaatggc
ttcaaaactctggctgaaggtcagaacgttgagttcgaaattcaggacggccagaaaggt
ccggcagctgttaacgtaacagctatctga
              
                            

Download fasta file
RegulonDB