RegulonDB RegulonDB 10.9: Gene Sequence
cspF gene sequence


Size: 213        A: 53  T: 57  G: 49  C: 54

Fasta

 

>cspF E. coli K12. Version NC_000913.3 GI:556503834
ttgtcccgtaaaatgacaggaattgtcaaaacctttgacggcaaaagcggcaagggtctt
atcaccccatccgatggtcgtatcgatgtccagcttcatgtttcagcgctcaatctccgc
gatgcagaagaaattaccaccggattacgcgtggaattttgccggataaatggtctgcgt
ggcccttcagctgccaatgtttacctttcatga
              
                            

Download fasta file
RegulonDB