RegulonDB RegulonDB 10.9: Gene Sequence
rlmA gene sequence


Size: 810        A: 194  T: 200  G: 219  C: 197

Fasta

 

>rlmA E. coli K12. Version NC_000913.3 GI:556503834
atgtctttttcctgtccactttgccatcagcctctttcgcgtgaaaaaaacagctatatc
tgtccccagcgacatcagtttgatatggcgaaagaagggtatgtcaatctgctgcccgtt
cagcataaacggtctcgtgatccgggcgacagcgcggaaatgatgcaagcacgccgcgca
ttcttagatgccggacattatcagccgctgcgtgatgcaattgtcgcccaactgagggaa
cggcttgatgataaggccacggcggtgctggatattggctgtggtgaagggtattacaca
cacgcatttgccgatgcgttgcccgaaatcaccacgtttggtctggatgtttcgaaggta
gcgataaaagcggcggcgaaacgctatccgcaggtcactttttgtgtcgcttccagccac
cgtttgccgttttccgataccagtatggacgccataatacgtatttacgcgccgtgtaaa
gcagaagaattagcacgagtagtgaagcccggcggctgggtcattactgccacgccggga
ccgcgacatttgatggagctgaaggggctgatttacaatgaagtacatcttcatgcacct
catgcagaacaactggaaggttttacattacagcagagtgcggagttgtgttatccgatg
cgtcttcgcggtgatgaagccgtcgcattattgcagatgacgccgtttgcctggcgtgcg
aagccagaagtctggcaaacactggcagcaaaagaagtgttcgactgccagacggacttt
aatattcacctctggcagcgttcttattaa
              
                            

Download fasta file
RegulonDB