RegulonDB RegulonDB 10.9: Gene Sequence
crcB gene sequence


Size: 384        A: 85  T: 113  G: 103  C: 83

Fasta

 

>crcB E. coli K12. Version NC_000913.3 GI:556503834
gtgttacaacttcttttagcagtttttattggcggtggtacgggaagcgtggcgagatgg
ctgttaagtatgcgatttaacccactgcatcaggcgattccgttggggacgctgacagca
aacctgattggggcattcatcataggaataggattcgcatggttcagcaggatgacgaac
attgatccagtgtggaaagtattaatcaccaccggattttgtggcggtctaacaaccttc
tcaacattttcggcagaagtggtgtttttgttacaagagggccgctttggctgggcatta
ctgaacgttttcgtcaaccttctggggtcttttgccatgaccgcactggcattctggctg
ttttcggcctcaaccgcacactaa
              
                            

Download fasta file
RegulonDB