RegulonDB RegulonDB 10.10: Gene Sequence
gadX gene sequence


Size: 825        A: 234  T: 253  G: 186  C: 152

Fasta

 

>gadX E. coli K12. Version NC_000913.3 GI:556503834
atgcaatcactacatgggaattgtctaattgcgtatgcaagacataaatatattctcacc
atggttaatggtgaatatcgctattttaatggcggtgacctggtttttgcggatgcaagc
caaattcgagtagataagtgtgttgaaaattttgtattcgtgtcaagggacacgctttca
ttatttctcccgatgctcaaggaggaggcattaaatcttcatgcacataaaaaagtttct
tcattactcgttcatcactgtagtagagatattcctgtttttcaggaagttgcgcaacta
tcgcagaataagaatcttcgctatgcagaaatgctacgtaaaagagcattaatctttgcg
ttgttatctgtttttcttgaggatgagcactttataccgctgcttctgaacgttttacaa
ccgaacatgcgaacacgagtttgtacggttatcaataataatatcgcccatgagtggaca
ctagcccgaatcgccagcgagctgttgatgagtccaagtctgttaaagaaaaaattgcgc
gaagaagagacatcatattcacagttgcttactgagtgtagaatgcaacgtgctttgcaa
cttattgttatacatggtttttcaattaagcgagttgcagtatcctgtggatatcacagc
gtgtcgtatttcatttacgtctttcgaaattattatgggatgacgcccacagagtatcag
gagcgatcggcgcagagattgtcgaaccgtgactcggcggcaagtattgttgcgcaaggg
aatttttacggcactgaccgttctgcggaaggaataagattatag
              
                            

Download fasta file
RegulonDB