RegulonDB RegulonDB 10.9: Gene Sequence
eptB gene sequence


Size: 1692        A: 398  T: 441  G: 445  C: 408

Fasta

 

>eptB E. coli K12. Version NC_000913.3 GI:556503834
atgagatacatcaaatcgattacacagcagaagctgagctttttgcttgcaatctatatt
ggcctttttatgaatggcgcggttttttaccgccgcttcggcagctatgcgcacgatttt
accgtctggaaaggcatttctgctgttgttgaactggccgccaccgtactggtgaccttc
tttttactacgtcttctttcgctgtttggccgccgcagctggcgtattctggcatcgctg
gtggtgctcttttccgcaggtgccagctattacatgaccttccttaatgtggtcattggt
tatggcatcatcgcttccgtcatgaccaccgatatcgacctgtcaaaagaagttgttggt
ctgaactttattctctggttaatcgccgttagtgcattgcctcttatccttatctggaat
aaccgctgtcgctacaccttgctccgacaactgcgaaccccagggcagcgtattcgcagc
ctggcggtcgtcgtactggcgggtattatggtttgggcaccgattcgtttgctggatatc
cagcagaagaaagtggagagggcgaccggcgttgatttgccgagttatggcggtgtcgta
gcgaactcttatctgccatcaaactggctttctgcgttggggctgtatgcctgggcgcgg
gtcgatgaatcttccgataataattcattgcttaatccggcgaagaaattcacttatcag
gcaccgcaaaacgttgatgacacttatgtcgtgtttatcatcggtgaaaccacgcgttgg
gaccatatgggtattttcggctatgagcgtaataccacgccgaaactggcccaggagaaa
aatctggcggcgttccgtggttactcctgtgataccgcaaccaaactctcactgcgttgc
atgtttgtacgtcaggggggcgcggaagataatccgcagcgcacattaaaagaacagaac
attttcgcggttctgaagcagttaggattcagttctgacctctacgctatgcagagcgaa
atgtggttctacagcaacacgatggcggacaacattgcttatcgtgagcagattggtgcg
gagccacgtaatcgtggcaagccggtagatgatatgttgctggtagacgaaatgcagcaa
tcgctagggcgcaacccggatggtaagcatctgatcattctgcataccaaaggttcgcat
tttaactacacccagcgttatccgcgtagcttcgcgcagtggaagccggaatgtattggt
gttgatagcggctgtaccaaagcgcagatgatcaactcctatgacaactcggtgacctat
gtggatcactttatctccagcgtgattgatcaggttcgcgataagaaagcgattgtgttc
tacgcagctgaccacggtgagtcaattaatgaacgcgagcacctgcacggcacgccgcgt
gaactggcaccgccggagcagttccgcgtaccgatgatggtctggatgtcagataaatat
ctggaaaatccggccaatgcgcaggcgtttgcgcagctgaaaaaagaagccgacatgaaa
gtgccacgccgtcacgtagagctgtacgataccatcatgggttgtcttggctatacttca
ccggatggtggaattaacgaaaacaacaactggtgtcacatcccgcaggcaaaagaggca
gcggctaactaa
              
                            

Download fasta file
RegulonDB