RegulonDB RegulonDB 10.8: Gene Sequence
xylG gene sequence


Size: 1542        A: 430  T: 386  G: 378  C: 348

Fasta

 

>xylG E. coli K12. Version NC_000913.3 GI:556503834
atgccttatctacttgaaatgaagaacattaccaaaaccttcggcagtgtgaaggcgatt
gataacgtctgcttgcggttgaatgctggcgaaatcgtctcactttgtggggaaaatggg
tctggtaaatcaacgctgatgaaagtgctgtgtggtatttatccccatggctcctacgaa
ggcgaaattatttttgcgggagaagagattcaggcgagtcacatccgcgataccgaacgc
aaaggtatcgccatcattcatcaggaattggccctggtgaaagaattgaccgtgctggaa
aatatcttcctgggtaacgaaataacccacaatggcattatggattatgacctgatgacg
ctacgctgtcagaagctgctcgcacaggtcagtttatccatttcacctgatacccgcgtt
ggcgatttagggcttgggcaacaacaactggttgaaattgccaaggcacttaataaacag
gtgcgcttgttaattctcgatgaaccgacagcctcattaactgagcaggaaacgtcgatt
ttactggatattattcgcgatctacaacagcacggtatcgcctgtatttatatttcgcac
aaactcaacgaagtcaaagcgatttccgatacgatttgcgttattcgcgacggacagcac
attggtacgcgtgatgctgccggaatgagtgaagacgatattatcaccatgatggtcggg
cgagagttaaccgcgctttaccctaatgaaccacataccaccggagatgaaatattacgt
attgaacatctgacggcatggcatccggttaatcgtcatattaaacgagttaatgatgtc
tcgttttccctgaaacgtggcgaaatattgggtattgccggactcgttggtgccggacgt
accgagaccattcagtgcctgtttggtgtgtggcccggacaatgggaaggaaaaatttat
attgatggcaaacaggtagatattcgtaactgtcagcaagccatcgcccaggggattgcg
atggtccccgaagacagaaagcgcgacggcatcgttccggtaatggcggttggtaaaaat
attaccctcgccgcactcaataaatttaccggtggcattagccagcttgatgacgcggca
gagcaaaaatgtattctggaatcaatccagcaactcaaagttaaaacgtcgtcccccgac
cttgctattggacgtttgagcggcggcaatcagcaaaaagcgatcctcgctcgctgtctg
ttacttaacccgcgcattctcattcttgatgaacccaccaggggtatcgatattggcgcg
aaatacgagatctacaaattaattaaccaactcgtccagcagggtattgccgttattgtc
atctcttccgaattacctgaagtgctcggccttagcgatcgtgtactggtgatgcatgaa
gggaaactaaaagccaacctgataaatcataacctgactcaggagcaggtgatggaagcc
gcattgaggagcgaacatcatgtcgaaaagcaatccgtctga
              
                            

Download fasta file
RegulonDB