RegulonDB RegulonDB 10.10: Gene Sequence
yiaK gene sequence


Size: 999        A: 239  T: 230  G: 263  C: 267

Fasta

 

>yiaK E. coli K12. Version NC_000913.3 GI:556503834
atgaaagtgacatttgagcagttaaaagcagcctttaatcgggtcttaatttcacgcggc
gttgacagcgaaacggctgacgcctgtgcagagatgttcgcccgcaccaccgaatccggc
gtttattctcacggcgttaatcgtttccctcgtttcattcaacaactggaaaacggcgat
atcattcctgatgcccaacccaaacgtataaccagcctcggcgcaattgaacagtgggac
gcccagcgttcgatcggtaacctgacagcgaaaaagatgatggatcgcgccattgaactg
gctgccgatcacggtattggtctggtggcactacgtaatgccaaccactggatgcgcggc
ggcagctacggctggcaggcggcggaaaaaggctatattggcatttgctggaccaactcc
atcgccgtaatgccgccgtggggcgcaaaagagtgtcgcataggcactaacccgctgatc
gtcgccattccttccacgccgatcaccatggtcgatatgtcgatgtcgatgttctcttac
ggcatgttagaagttaaccgtctggcaggtcgtcagctcccggtcgatggtggctttgat
gatgagggcaatttgaccaaagaacctggcgttatcgagaagaatcgccgcattttgccg
atgggctactggaaaggttctggcatgtcgattgtgctggatatgatcgctactctcctt
tccgacggcgcatccgttgccgaagtcacccaggacaacagcgacgaatacggcatttca
caaatttttattgccattgaagtggacaagcttatcgacggtcccacccgcgatgccaag
ctgcaacgcatcatggattacgttactagtgccgagcgtgctgacgaaaatcaggccatt
cgcttacccggccatgaatttactaccctgctggccgaaaaccgccgtaacggcatcact
gttgatgacagcgtgtgggccaaaatccaggcgttatga
              
                            

Download fasta file
RegulonDB