RegulonDB RegulonDB 10.10: Gene Sequence
yiaM gene sequence


Size: 474        A: 113  T: 152  G: 95  C: 114

Fasta

 

>yiaM E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaatactcgaagcaatactggcgattaatctcgccgtactttcctgtattgta
tttataaacattattttaagatatggttttcagacaagcattttatctgttgatgaattg
tcacgttatttatttgtctggttaacgtttattggcgcgattgtagcttttatggataac
gcccacgttcaggtcacctttctggtggagaaactctcccccgcatggcagcgacgagtc
gctctggttacccattccttaatcttatttatttgtggcgcactggcctggggcgcaacg
ctaaaaacaattcaggactggagcgattattcaccgatcctcggtttacccatcggcctg
atgtatgccgcttgtctgcccaccagcctcgttatcgcattctttgaactgcgtcattta
tatcaactcatcacgcgtagcaattctctaacgtcgccaccgcaaggagcttaa
              
                            

Download fasta file
RegulonDB