RegulonDB RegulonDB 11.0: Gene Sequence
yiaO gene sequence


Size: 987        A: 265  T: 217  G: 247  C: 258

Fasta

 

>yiaO E. coli K12. Version NC_000913.3 GI:556503834
atgaaattacgctctgtaacctacgcattattcattgctggcctggctgcattcagcaca
tcttctctggcggcacaatctttacgtttcggttatgaaacatcacaaaccgactcgcaa
catattgcggcgaaaaaattcaatgatttattgcaggagagaaccaaaggcgagctgaaa
ttaaaactgttcccggacagcactctcggtaacgcgcaggcgatgatcagcggcgtacgt
ggcggcaccatcgatatggaaatgtccggctcgaataactttgccgggttatcaccagtg
atgaacttgcttgatgtccctttcctgttccgcgataccgctcacgcgcataaaacgctc
gacggcaaagtcggtgatgatctgaaagcctcacttgaaggtaaaggactgaaagtactg
gcctactgggaaaacggctggcgcgatgtcaccaactcgcgcgcaccggttaaaaccccc
gccgacctgaaagggctgaaaatccgcaccaacaatagcccgatgaatatcgccgcattc
aaagtctttggcgctaacccgatcccgatgccgtttgccgaagtctataccgggctggaa
acccgcactatcgacgctcaggaacacccgatcaacgtcgtctggtcagcaaaatttttc
gaagtgcagaagttcctttctctgacgcaccacgcctattccccgcttctggtggtgatc
aacaaagcgaagtttgatggcttaagtccggagttccagcaggcgctagtttcatctgca
caagaagcgggtaactatcagcgcaaactggttgctgaagatcagcaaaaaatcatcgac
ggcatgaaagaagcgggcgtggaagtcatcaccgatctcgaccgcaaagcctttagcgac
gcactggggaatcaggttcgcgacatgtttgttaaagatgtgccgcagggagctgatctg
ctgaaagccgtggatgaggtgcaataa
              
                            

Download fasta file
RegulonDB