RegulonDB RegulonDB 10.10: Gene Sequence
sgbU gene sequence


Size: 861        A: 196  T: 185  G: 263  C: 217

Fasta

 

>sgbU E. coli K12. Version NC_000913.3 GI:556503834
gtgcgtaatcatcagttagggatttatgaaaaagcgctggcgaaagatctctcctggccg
gagcggctggtgctggcaaaaagctgcggttttgattttgtcgaaatgtcggtggatgaa
accgacgaacggctctcacgtcttgactggagcgccgcacaaaggacttcgctggttgcc
gcgatgatcgaaacaggtgttgggatcccgtcgatgtgcctgtccgcacatcgtcgcttt
ccctttggtagccgtgacgaggcagtgcgcgaacgggcgcgggaaatcatgagtaaagcg
attcgcctggcgcgcgatctcggcattcgcaccatccagctggcaggttatgacgtctat
tacgaagaccacgacgaaggcacccggcaacgttttgctgaagggctggcgtgggcagtc
gaacaggcggcggcatcacaagtaatgctggcggtggagattatggataccgcgtttatg
aactccatcagcaaatggaaaaaatgggacgagatgctcgcctcaccgtggttcaccgtc
tacccggacgtcggcaacctcagcgcctggggcaatgatgttcccgccgaactgaaactg
ggcattgaccgtatcgccgcgatccacctgaaagacacccagccagtcaccgggcaaagt
cccggacagttccgcgacgtgccgtttggcgaaggctgcgtcgatttcgttggcatcttc
aaaacgctgcataaactgaactatcgcggttctttcctgattgagatgtggaccgaaaaa
gccaaagagccggtgctggagattattcaggcgcggcgttggattgaagcgcgtatgcag
gaggctggatttatatgttag
              
                            

Download fasta file
RegulonDB