RegulonDB RegulonDB 10.8: Gene Sequence
aldB gene sequence


Size: 1539        A: 361  T: 335  G: 462  C: 381

Fasta

 

>aldB E. coli K12. Version NC_000913.3 GI:556503834
atgaccaataatcccccttcagcacagattaagcccggcgagtatggtttccccctcaag
ttaaaagcccgctatgacaactttattggcggcgaatgggtagcccctgccgacggcgag
tattaccagaatctgacgccggtgaccgggcagctgctgtgcgaagtggcgtcttcgggc
aaacgagacatcgatctggcgctggatgctgcgcacaaagtgaaagataaatgggcgcac
acctcggtgcaggatcgtgcggcgattctgtttaagattgccgatcgaatggaacaaaac
ctcgagctgttagcgacagctgaaacctgggataacggcaaacccattcgcgaaaccagt
gctgcggatgtaccgctggcgattgaccatttccgctatttcgcctcgtgtattcgggcg
caggaaggtgggatcagtgaagttgatagcgaaaccgtggcctatcatttccatgaaccg
ttaggcgtggtggggcagattatcccgtggaacttcccgctgctgatggcgagctggaaa
atggctcccgcgctggcggcgggcaactgtgtggtgctgaaacccgcacgtcttaccccg
ctttctgtactgctgctaatggaaattgtcggtgatttactgccgccgggcgtggtgaac
gtggtcaatggcgcaggtggggtaattggcgaatatctggcgacctcgaaacgcatcgcc
aaagtggcgtttaccggctcaacggaagtgggccaacaaattatgcaatacgcaacgcaa
aacattattccggtgacgctggagttgggcggtaagtcgccaaatatcttctttgctgat
gtgatggatgaagaagatgcctttttcgataaagcgctggaaggctttgcactgtttgcc
tttaaccagggcgaagtttgcacctgtccgagtcgtgctttagtgcaggaatctatctac
gaacgctttatggaacgcgccatccgccgtgtcgaaagcattcgtagcggtaacccgctc
gacagcgtgacgcaaatgggcgcgcaggtttctcacgggcaactggaaaccatcctcaac
tacattgatatcggtaaaaaagagggcgctgacgtgctcacaggcgggcggcgcaagctg
ctggaaggtgaactgaaagacggctactacctcgaaccgacgattctgtttggtcagaac
aatatgcgggtgttccaggaggagatttttggcccggtgctggcggtgaccaccttcaaa
acgatggaagaagcgctggagctggcgaacgatacgcaatatggcctgggcgcgggcgtc
tggagccgcaacggtaatctggcctataagatggggcgcggcatacaggctgggcgcgtg
tggaccaactgttatcacgcttacccggcacatgcggcgtttggtggctacaaacaatca
ggtatcggtcgcgaaacccacaagatgatgctggagcattaccagcaaaccaagtgcctg
ctggtgagctactcggataaaccgttggggctgttctga
              
                            

Download fasta file
RegulonDB