RegulonDB RegulonDB 10.9: Gene Sequence
rutR gene sequence


Size: 639        A: 155  T: 156  G: 183  C: 145

Fasta

 

>rutR E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaaggcgcagtgaaaacaacgggtaaacgttcgcgcgcagtaagcgcgaagaaa
aaagcgattcttagcgcagcactggacactttttcacaattcggttttcacggcacaagg
ctggagcagatcgcagagttggcgggtgtttcaaaaaccaatctgctgtattactttccg
tcaaaagaggcgctgtatattgccgtgctgcggcagattctcgatatctggctggcaccg
ttaaaagcgtttcgtgaagatttcgccccgctggcggcgatcaaagagtacatccgtctg
aagctggaagtctcacgcgattatccgcaggcttcgcgcctgttctgtatggagatgctg
gcaggcgcgccgctgttaatggatgaactgacgggcgatttgaaggcattaattgatgag
aaatcggcgctgattgccggttgggtcaaaagcggcaaactcgcgccgattgatccgcag
catttgatttttatgatttgggcttccactcaacattacgccgatttcgcccctcaggtg
gaggcggtgacaggcgcgacgttgcgcgatgaggtatttttcaatcaaacggttgaaaac
gtgcagcggattattattgaggggattcgaccacgttaa
              
                            

Download fasta file
RegulonDB