RegulonDB RegulonDB 10.9: Gene Sequence
yjtD gene sequence


Size: 687        A: 182  T: 163  G: 185  C: 157

Fasta

 

>yjtD E. coli K12. Version NC_000913.3 GI:556503834
atgcgtataacgattattctggtcgcacccgccagagcagaaaatattggggcagcggcg
cgggcaatgaaaacgatggggtttagcgatctgcggattgtcgatagtcaggcacacctg
gagccagccacccgctgggtcgcacatggatctggtgatattattgataatattaaagtt
ttcccgacattggctgaatcgttacacgatgtcgatttcactgtcgccaccactgcgcgc
agtcgggcgaaatatcattactacgccacgccagttgaactggtgccgctgttagaggaa
aaatcttcatggatgagccatgccgcgctggtgtttggtcgcgaagattccgggttgact
aacgaagagttagcgttggctgacgttcttactggtgtgccgatggtggcggattatcct
tcgctcaatctggggcaggcggtgatggtctattgctatcaattagcaacattaatacaa
caaccggcgaaaagtgatgcaacggcagaccaacatcaactgcaagctttacgcgaacga
gccatgacattgctgacgactctggcagtggcagatgacataaaactggtcgactggtta
caacaacgcctggggcttttagagcaacgagacacggcaatgttgcaccgtttgctgcat
gatattgaaaaaaatatcaccaaataa
              
                            

Download fasta file
RegulonDB