RegulonDB RegulonDB 10.9: Gene Sequence
pepB gene sequence


Size: 1284        A: 293  T: 261  G: 403  C: 327

Fasta

 

>pepB E. coli K12. Version NC_000913.3 GI:556503834
atgacagaagcgatgaagattaccctctctacccaacctgccgacgcgcgctggggagaa
aaagcaacttacagcattaataatgacggcattaccctgcatttgaacggggcagacgat
ctggggctgatccagcgtgcggcgcgcaagattgacggtctgggcatcaagcatgttcag
ttaagcggtgaaggctgggatgcggatcgctgctgggcattctggcaaggttacaaagcc
ccgaaaggcacgcgtaaagtggtgtggccggatctggacgatgcccagcgccaggaactg
gataaccgcctgatgatcatcgactgggtgcgtgacaccatcaacgcaccggcagaagaa
ttgggaccatcgcaactggcacagcgtgctgttgatctgatcagcaacgtcgcgggcgat
cgtgtgacttatcggatcaccaaaggcgaagatctgcgtgagcaaggttatatggggctg
cacacagtcggacgcggttcagaacgttctccggtattgctggcgctggattacaaccca
actggcgataaagaagcgccagtgtacgcgtgcctggtaggtaaaggtatcacttttgac
tccggcggctacagcatcaaacagactgcgtttatggactcgatgaagtcggacatgggc
ggcgcggcaacggttaccggggcgctggcatttgccattacgcgcggactgaacaagcgc
gtgaagctgttcctctgctgtgcggataacctgattagcggcaatgcgttcaagctgggc
gatatcatcacctatcgcaacggtaaaaaagttgaagtgatgaacactgatgccgaaggg
cgtctggtgcttgccgatggtctgattgatgccagtgcgcagaaaccggaaatgatcatt
gatgcggcgaccctcaccggggcggcgaaaactgcgctgggtaatgattatcacgcgctg
ttcagttttgacgatgcgctggccggtcgcttgctggcgagtgccgcgcaggagaacgaa
ccgttctggcgtctgccgctggcggagttccaccgcagccagctgccgtctaactttgcc
gaactgaacaataccggaagcgcggcgtatccggcaggcgcgagcacggcggcgggcttc
ctgtcgcactttgttgagaactatcagcaaggctggctgcatatcgactgctcggcgact
taccgtaaagcgccggttgaacagtggtctgcgggcgctacgggacttggtgtgcgcacg
atagctaatctgttaacggcgtaa
              
                            

Download fasta file
RegulonDB