RegulonDB RegulonDB 10.10: Gene Sequence
zapD gene sequence


Size: 744        A: 170  T: 191  G: 188  C: 195

Fasta

 

>zapD E. coli K12. Version NC_000913.3 GI:556503834
atgcagacccaggtcctttttgaacatccactaaatgaaaaaatgcgtacatggctgcgc
attgagtttttgattcagcaactcaccgttaatttacccatcgttgaccacgctggcgcg
ctgcatttcttccgtaatgtcagtgaattactggatgttttcgagcgcggcgaagtccgc
actgagctgttgaaagaacttgaccggcagcaacgtaaactccagacctggattggcgtg
cctggcgtggaccagagccgtattgaagcattaattcagcagttaaaagcggcggggagc
gtattaatttccgcgccgcgtatcgggcaatttctgcgtgaagatcgtttgattgctctg
gtgcgtcagcgactgagcatcccaggcggctgttgcagctttgatttacctacattgcac
atttggctgcatctaccccaggcgcagcgcgacagccaggtagaaacctggattgccagc
ctgaacccgctcacccaggcacttaccatggtgctggatttaattcgccagtcggccccc
ttccgtaaacaaaccagcctgaatggtttttatcaggataacggtggcgatgccgacttg
ctgcgcctgaatctgtcgctcgattcacagctttatccgcaaatttccggacataagagc
cgttttgccattcgttttatgccgctggacactgaaaacggacaggtaccggaacgtctg
gatttcgaactggcctgttgctaa
              
                            

Download fasta file
RegulonDB