RegulonDB RegulonDB 10.10: Gene Sequence
yacG gene sequence


Size: 198        A: 56  T: 40  G: 57  C: 45

Fasta

 

>yacG E. coli K12. Version NC_000913.3 GI:556503834
atgtcagaaactattacggtgaattgcccaacctgcgggaaaacggtggtgtggggtgaa
atcagcccgtttcggccattttgctccaaacgttgtcagctgatcgacctcggagaatgg
gctgctgaagaaaaacgaatccccagcagtggcgatctttccgaaagcgatgactggagc
gaagaaccaaagcagtga
              
                            

Download fasta file
RegulonDB