RegulonDB RegulonDB 10.10: Gene Sequence
acnB gene sequence


Size: 2598        A: 579  T: 567  G: 749  C: 703

Fasta

 

>acnB E. coli K12. Version NC_000913.3 GI:556503834
gtgctagaagaataccgtaagcacgtagctgagcgtgccgctgaggggattgcgcccaaa
cccctggatgcaaaccaaatggccgcacttgtagagctgctgaaaaacccgcccgcgggc
gaagaagaattcctgttagatctgttaaccaaccgtgttcccccaggcgtcgatgaagcc
gcctatgtcaaagcaggcttcctggctgctatcgcgaaaggcgaagccaaatcccctctg
ctgactccggaaaaagccatcgaactgctgggcaccatgcagggtggttacaacattcat
ccgctgatcgacgcgctggatgatgccaaactggcacctattgctgccaaagcactttct
cacacgctgctgatgttcgataacttctatgacgtagaagagaaagcgaaagcaggcaac
gaatatgcgaagcaggttatgcagtcctgggcggatgccgaatggttcctgaatcgcccg
gcgctggctgaaaaactgaccgttactgtcttcaaagtcactggcgaaactaacaccgat
gacctttctccggcaccggatgcgtggtcacgcccggatatcccactgcacgcgctggcg
atgctgaaaaacgcccgtgaaggtattgagccagaccagcctggtgttgttggtccgatc
aagcaaatcgaagctctgcaacagaaaggtttcccgctggcgtacgtcggtgacgttgtg
ggtacgggttcttcgcgtaaatccgccactaactccgttctgtggtttatgggcgatgat
attccacatgtgccgaacaaacgcggcggtggtttgtgcctcggcggtaaaattgcaccc
atcttctttaacacgatggaagacgcgggtgcactgccaatcgaagtcgacgtctctaac
ctgaacatgggcgacgtgattgacgtttacccgtacaaaggtgaagtgcgtaaccacgaa
accggcgaactgctggcgaccttcgaactgaaaaccgacgtgctgattgatgaagtgcgt
gctggtggccgtattccgctgattatcgggcgtggcctgaccaccaaagcgcgtgaagca
cttggtctgccgcacagtgatgtgttccgtcaggcgaaagatgtcgctgagagcgatcgc
ggcttctcgctggcgcaaaaaatggtaggccgtgcctgtggcgtgaaaggcattcgtccg
ggcgcgtactgtgaaccgaaaatgacttctgtaggttcccaggacaccaccggcccgatg
acccgtgatgaactgaaagacctggcgtgcctgggcttctcggctgacctggtgatgcag
tctttctgccacaccgcggcgtatccgaagccagttgacgtgaacacgcaccacacgctg
ccggacttcattatgaaccgtggcggtgtgtcgctgcgtccgggtgacggcgtcattcac
tcctggctgaaccgtatgctgctgccggataccgtcggtaccggtggtgactcccatacc
cgtttcccgatcggtatctctttcccggcgggttctggtctggtggcgtttgctgccgca
actggcgtaatgccgcttgatatgccggaatccgttctggtgcgcttcaaaggcaaaatg
cagccgggcatcaccctgcgcgatctggtacacgctattccgctgtatgcgatcaaacaa
ggtctgctgaccgttgagaagaaaggcaagaaaaacatcttctctggccgcatcctggaa
attgaaggtctgccggatctgaaagttgagcaggcctttgagctaaccgatgcgtccgcc
gagcgttctgccgctggttgtaccatcaagctgaacaaagaaccgatcatcgaatacctg
aactctaacatcgtcctgctgaagtggatgatcgcggaaggttacggcgatcgtcgtacc
ctggaacgtcgtattcagggcatggaaaaatggctggcgaatcctgagctgctggaagcc
gatgcagatgcggaatacgcggcagtgatcgacatcgatctggcggatattaaagagcca
atcctgtgtgctccgaacgacccggatgacgcgcgtccgctgtctgcggtacagggtgag
aagatcgacgaagtgtttatcggttcctgcatgaccaacatcggtcacttccgtgctgcg
ggtaaactgctggatgcgcataaaggtcagttgccgacccgcctgtgggtggcaccgcca
acccgtatggacgccgcacagttgaccgaagaaggctactacagcgtcttcggtaagagt
ggtgcgcgtatcgagatccctggctgttccctgtgtatgggtaaccaggcgcgtgtggcg
gacggtgcaacggtggtttccacctctacccgtaacttcccgaaccgtctgggtactggc
gcgaatgtcttcctggcttctgcggaactggcggctgttgcggcgctgattggcaaactg
ccgacgccggaagagtaccagacctacgtggcgcaggtagataaaacagccgttgatact
taccgttatctgaacttcaaccagctttctcagtacaccgagaaagccgatggggtgatt
ttccagactgcggtttaa
              
                            

Download fasta file
RegulonDB