RegulonDB RegulonDB 10.9: Gene Sequence
yadH gene sequence


Size: 771        A: 130  T: 250  G: 211  C: 180

Fasta

 

>yadH E. coli K12. Version NC_000913.3 GI:556503834
atgatgcatctttactgggtggcgctaaaaagcatctgggcgaaagagatccatcgcttt
atgcgtatctgggtgcagacgctggtgccgccagtcatcaccatgaccctttactttatt
atcttcggtaacctgattggttcgcgtattggcgatatgcatggcttcagctatatgcag
ttcatcgtaccggggctgatcatgatgtcggtgatcaccaatgcctacgccaacgttgcg
tcatcattttttggtgccaagttccagcgtaatattgaagagctgctggtagcgccggtt
ccgactcacgtcattattgccggatatgtcggcggtggcgtggcgcgtggtctgtttgtt
ggcattctggtgacggcaatttcactgttttttgtgccatttcaggtgcattcgtgggta
ttcgttgccttaacgctggtgctcacggcggtgttgttctcccttgcgggtttgctgaac
ggtgtgtttgccaaaacgttcgatgacatcagcctggtgccaacctttgtgttaacgcca
ctcacgtatttgggcggggtcttttactcactgactttgttgccgccgttctggcaaggg
ctgtcgcacctgaacccaatcgtttatatgatcagtggtttccgctacggcttcctcggt
atcaatgatgttccgctggtcactacctttggcgtactggtggtctttattgtggcgttt
tatttgatctgttggtcgctgatccaacgtggacgtggtttgcgtagctaa
              
                            

Download fasta file
RegulonDB