RegulonDB RegulonDB 10.9: Gene Sequence
rpnE gene sequence


Size: 900        A: 237  T: 228  G: 208  C: 227

Fasta

 

>rpnE E. coli K12. Version NC_000913.3 GI:556503834
atgaccgaatcaacaacctcctccccgcatgatgcggtatttaaaacctttatgttcaca
cccgaaaccgcacgggattttctcgaaatacatttaccagaaccactgcgcaagctttgc
aacctgcaaaccttacgcctggaacccactagttttattgaaaaaagtttacgcgcttac
tactcggatgttttgtggtccgtggaaaccagcgacggtgacggctatatctactgcgtg
attgaacatcaaagctctgcagaaaagaatatggcttttcggctaatgcgctatgccact
gccgccatgcagcgtcaccaggacaaaggctatgacagagtcccgctggtggtgccgttg
ctgttttatcatggcgaaacctcgccttacccgtactcactcaactggctggatgagttt
gacgatccgcaacttgcccggcagttgtacaccgaagcttttctgttggtggatatcacc
atcgtacctgacgatgagatcatgcaacatcggcgtatagctctgctggaactgattcaa
aagcatattcgcgaccgcgatttaatcggcatggtcgacaggatcaccacgcttttggtt
agaggcttcactaatgacagccagctacaaacactgtttaattatctgctgcaatgcggc
gatacctcccgtttcacccgttttattgaggagattgccgaacgttcaccactacaaaag
gagagattaatgactattgctgaacggctacggcaggaagggcatcaaattggctggcag
gaaggtatgcatgaacaagccattaaaattgctttgcgcatgctggagcagggctttgaa
cgtgagattgtgctggcgacaacccaactcactgatgctgatattccgaactgtcattaa
              
                            

Download fasta file
RegulonDB