RegulonDB RegulonDB 10.9: Gene Sequence
yadK gene sequence


Size: 597        A: 166  T: 184  G: 135  C: 112

Fasta

 

>yadK E. coli K12. Version NC_000913.3 GI:556503834
atgcatcccactcaacgtaagctgatgaagagaataattctgtttctgtcattactgttt
tgcatcgcctgtccagccattgctggacaggatattgaccttgttgccaatgtaaaaaac
agcacctgcaaaagcggaatcagtaaccagggtaatattgatcttggcgtcgttggggtg
ggatatttttcaggtaatgttactcctgaaagttatcaaccaggtggaaaagagttcact
atcactgtatccgactgtgcattacagggaactggcgatgtgctaaatcagttacatatt
gattttagagcccttagcggtgtcatggctgctggctctaggcaaatatttgctaatgaa
atttcgtcaggagcaagtaatgtaggagtagttatattttctactcaggattcggcgaat
acattcaatgttcttaatgcttcaggcggatctcgttccgtttatccagtaatgtcggat
gacatgaatggttcatcctggaaatttagcacccgaatgcaaaaaatcgatcctgcattg
agtgttacatctggtcaacttatgagccatgtgttagtggatatttactacgaataa
              
                            

Download fasta file
RegulonDB