RegulonDB RegulonDB 10.9: Gene Sequence
yadL gene sequence


Size: 606        A: 190  T: 158  G: 130  C: 128

Fasta

 

>yadL E. coli K12. Version NC_000913.3 GI:556503834
atgatgacatttaaaaatttacgttatggattatccagcagtgtcgttttggctgcctca
ttgttcagcgtactctcttatgcggcaacagacagtattggactgaccgttattactact
gtagaaatgggtacttgtaccgctacattagtaaatgactctgatcaggacatttctgtt
gttgattttggtgatgtatatatttctgaaatcaatgccaagaccaaagtaaaaacattc
aaactcaaattcaaagactgtgcgggtatccccaataaaaaagcgcaaataaaattaacc
aagcgagccacatgcgagggaactgctaatgacggtgcggggtttgcaaatggttccaca
gccgcagataaagcaagtgctgtcgccgttgaagtctggagcactgtaactccggcaaca
gggagtgcaacacaatttagctgtgtaacaccagcatcacaagaggtaacaatctccact
gcagccaatgcggtcgtttattatccgatgagtgcacgcctggtcgtggaaaaaaataaa
accgtaaacaatgtcactgcgggtaagttttctgcaccagccacatttacagtaacctat
aactaa
              
                            

Download fasta file
RegulonDB