RegulonDB RegulonDB 10.9: Gene Sequence
yadM gene sequence


Size: 570        A: 185  T: 141  G: 126  C: 118

Fasta

 

>yadM E. coli K12. Version NC_000913.3 GI:556503834
atgataaaaacaacgccacataaaatagtgatactgatgggaatattattatcaccctca
gtatttgcaacggatattaatgtagagtttacagccactgtcaaagcgacaacctgtaac
atcacacttactggtaataacgtcacgaatgatggcaataataactacacattgagaatc
cctaagatgggtctggataagatcgcgaataaaacgacagaatctcaggctgattttaaa
ctggttgccagtgggtgcagcagtggcatcagttggattgataccactctgaccggaaat
gcatcatcaagctcacctaagcttattataccgcagtctggtgattcatcttcgacgaca
agtaatatcggtatgggtttcaaaaaacggactactgatgatgccactttccttaaacct
aacagtgcggaaaagatacgctggagcacagacgagatgcagcccgataagggtcttgaa
atgaccgttgcgctacgtgaaacagatgcagggcaaggcgtaccggggaattttcgtgca
ctggcgacgtttaatttcatctatcaataa
              
                            

Download fasta file
RegulonDB