RegulonDB RegulonDB 10.9: Gene Sequence
hrpB gene sequence


Size: 2430        A: 542  T: 513  G: 750  C: 625

Fasta

 

>hrpB E. coli K12. Version NC_000913.3 GI:556503834
gtgtcgtcgttgcccgttgctgccgtcttacctgaattacttaccgctctcgattgtgcg
ccgcaggtattattaagtgcgccgaccggggccgggaaatcaacctggctgccgctgcaa
ctgctggcgcatcccggcattaacgggaaaattatcctgctggagccgcgtcgtctggcg
gcgcgtaacgtcgcgcaacggctggcggagctgcttaacgaaaagccaggcgataccgtt
ggctaccggatgcgtgcgcaaaactgcgtcgggccgaatacccgcctggaagtggttacc
gaaggcgtgctgacgcgcatgatccagcgtgacccggaactgagcggtgttggactggtg
atccttgatgaatttcatgagcgcagcttgcaggcggatttggcgttggcgctgttactc
gatgtgcaacaaggtctgcgtgatgaccttaaactgctgattatgtcggctaccctggac
aacgaccgcttgcagcaaatgctgccagaagcgcctgtcgtcatctcagaagggcgctcg
tttccggttgaacgccgttatttaccgctgcccgcgcatcagcgttttgacgatgccgtt
gcggtagccaccgctgaaatgctgcgtcaggaaagcggatcattactgttatttttacct
ggcgtcggagaaattcagcgtgtgcaggaacaactggcttcgcgcatcggcagtgatgta
ttgctctgcccgctgtatggcgcgttgtcgctgaacgatcagcgaaaagcgatcctcccg
gcaccgcaagggatgcgcaaagtggtgctggcgaccaatattgctgaaaccagtttaacc
attgaaggtattcgtctggtggtggattgtgcccaggagcgtgtggcgcgttttgatccg
cgcacggggcttacgcgactgattactcaacgcgttagccaggcatccatgacgcagcgt
gccgggcgcgccgggcgtctggagccgggtatcagcctgcatttaatcgccaaagaacaa
gcagaacgcgccgcggcgcaaagtgaaccggagatcttacaaagcgatctttccggtttg
ctgatggaattactgcaatggggatgcagcgatccggcgcagatgagctggctggatcaa
ccgccagtagtgaatctactggccgcgaaacgtctgttacaaatgctgggggcactggag
ggtgaacggcttagtgcgcaagggcaaaaaatggcagcgctgggtaacgatccgcgttta
gcggcaatgctggttagcgcgaagaacgacgacgaagctgctaccgcggcaaaaattgcc
gccattctcgaagagccgccacggatgggcaatagtgacctgggcgtggcgttttcgcgc
aatcaaccagcctggcagcaacgtagtcagcaactgttaaaacgcttaaacgtacgtggc
ggtgaggcagacagttcgcttatcgcgccgctacttgccggggcgtttgccgatcgcatt
gctcgtcgccgtgggcaagatggacgctatcaactggcaaacggcatgggagcgatgctc
gatgccaacgacgcgctaagccgccacgaatggttgatcgcaccgttattattgcagggc
agcgcctcgccggatgcgcggattttactggcgctgctggtcgatattgatgagttagta
caacgctgcccgcagctggtacagcagtctgacactgtggagtgggatgacgcgcaaggt
acgctgaaagcctggcgtcggctacaaatcggtcagttgacggtgaaagtgcagccgctg
gcgaaaccgtcagaagacgagttgcatcaggcgatgcttaatggcatccgtgataaaggt
ttaagcgtgctcaactggacggcggaagcggaacagctacgcttgcgtttgttatgcgcc
gcaaagtggttgccggaatatgactggccagcggttgatgatgaaagtttattggcagcg
ctggaaacgtggctgctgccacatatgactggcgtacattcactacgcggcctgaaatca
ctcgacatttatcaggcactacgcggattacttgattggggaatgcagcaacgtctggat
agtgaattgcctgcgcattacactgtgccgacgggaagccggatcgccattcgttatcat
gaagataacccgcccgcgctggcggtgagaatgcaagagatgtttggcgaggccaccaat
ccgacgatcgcccaggggcgcgtgccgctggtgctggagttgctttcacctgcccaaagg
ccattacaaatcacacgagatttgagcgacttctggaaaggagcgtaccgtgaggtgcaa
aaagagatgaaagggcgttatcccaaacatgtctggccggacgacccggcaaatactgca
ccgacgcgacggacgaaaaagtattcgtaa
              
                            

Download fasta file
RegulonDB