RegulonDB RegulonDB 10.9: Gene Sequence
erpA gene sequence


Size: 345        A: 85  T: 85  G: 95  C: 80

Fasta

 

>erpA E. coli K12. Version NC_000913.3 GI:556503834
atgagtgatgacgtagcactgccgctggagtttaccgacgcagcagccaacaaagttaaa
agcctgatcgctgacgaagataacccgaatctgaaattacgcgtgtatatcaccggtggc
ggttgcagcggcttccagtatggtttcacctttgatgatcaggtgaacgaaggcgatatg
accatcgaaaaacagggcgttggcctggtggttgatccgatgagcctgcaatatctggtc
ggcggttccgttgattataccgaaggtctggaaggttctcgtttcatcgtgaccaacccg
aacgcgaaaagcacctgcggttgcggttcttcctttagtatctaa
              
                            

Download fasta file
RegulonDB