RegulonDB RegulonDB 10.9: Gene Sequence
yadS gene sequence


Size: 624        A: 118  T: 171  G: 189  C: 146

Fasta

 

>yadS E. coli K12. Version NC_000913.3 GI:556503834
atgctcgtctattggctggatatagtcggcacagcggtatttgccatctccggcgttttg
ttagccggaaaattgcgtatggacccttttggtgttctggtactgggcgtggtaaccgca
gtaggcggcgggacaattcgcgacatggcgctggatcacggcccggtattttgggtgaaa
gatcccaccgatctggtcgttgcaatggtcaccagcatgctgaccatcgtgctggtgcgc
cagccaagacgcttaccaaaatggatgttgccggtgctggacgccgttggtctggcggtg
tttgtcggcattggcgtgaataaagcctttaatgcggaagccggtccgttaatcgcggtt
tgtatgggcgtcattactggcgttggcggcgggatcattcgtgatgttctggcccgcgaa
atccccatgattttacgtacagaaatctacgcaactgcctgtattatcggcggtattgtc
cacgctacggcttattacacattttccgtaccactggaaacagccagtatgatgggcatg
gtcgtgacgctattgattcggctggcggctattcgttggcatcttaagctaccgacgttt
gcgctggatgagaatgggcgttga
              
                            

Download fasta file
RegulonDB