RegulonDB RegulonDB 10.9: Gene Sequence
btuF gene sequence


Size: 801        A: 198  T: 179  G: 207  C: 217

Fasta

 

>btuF E. coli K12. Version NC_000913.3 GI:556503834
atggctaagtcactgttcagggcgctggtcgccctgtcttttcttgcgccactgtggctc
aacgccgcgccgcgcgtcatcacgctttctcccgccaacactgaacttgcctttgccgcc
gggatcacgccggttggggtcagcagctattccgactatcctccacaagcgcaaaagatt
gagcaggtttccacctggcaggggatgaatctggaacgcattgtcgcgctgaaacccgat
ctggtgattgcctggcgtggaggtaatgccgagcggcaggttgaccagctggcttcgctg
ggaataaaagtgatgtgggtcgatgcgacaagcattgaacaaattgccaatgcgttacgt
caactggccccctggagtccgcaaccagacaaggccgaacaagccgcgcaatccctgctg
gatcagtacgcgcaattgaaagcgcaatatgctgataaacctaaaaaacgtgtttttctg
caattcggcattaatccgccatttaccagtggaaaagagtcgattcagaaccaggtactc
gaagtttgtggcggagaaaacatctttaaagacagccgggttccctggccgcaagttagc
cgcgaacaggtgttagcacgctcgccacaggcgattgtcattacaggcggaccggaccaa
attcctaaaatcaaacaatactggggtgaacagctcaaaattcccgttattcctctcacg
agtgactggtttgaacgtgcaagcccacgtattatcctcgctgcacaacagctctgtaat
gcgctttcacaggtagattag
              
                            

Download fasta file
RegulonDB