RegulonDB RegulonDB 10.9: Gene Sequence
cdaR gene sequence


Size: 1158        A: 273  T: 273  G: 358  C: 254

Fasta

 

>cdaR E. coli K12. Version NC_000913.3 GI:556503834
atggctggctggcatcttgataccaaaatggcgcaggatatcgtggcacgtaccatgcgc
atcatcgataccaatatcaacgtaatggatgcccgtgggcgaattatcggcagcggcgat
cgtgagcgtattggtgaattgcacgaaggtgcattgctggtactttcacagggacgagtc
gtcgatatcgatgacgcggtagcacgtcatctgcacggtgtgcggcaggggattaatcta
ccgttacggctggaaggtgaaattgtcggcgtaattggcctgacaggtgaaccagagaat
ctgcgtaaatatggcgaactggtctgcatgacggctgaaatgatgctggaacagtcgcgg
ttgatgcacttgttggcgcaggatagccgtttgcgggaagaactggtgatgaacctgatt
caggcagaggagaatactcccgcacttactgaatgggcgcaacggctggggatcgatctc
aatcaaccgcgagtggtggctattgttgaggtcgacagcggtcagcttggcgtggacagc
gcaatggcggagttacaacaactgcaaaacgcgctgactacgcccgagcgtaataatctg
gtggcgattgtctcgctaaccgaaatggtggtgttgaaaccggcgttgaactcttttggg
cgctgggatgcagaagatcatcgtaagcgagttgaacaactgattacccgcatgaaagag
tacggccagctgcgttttcgcgtttcactgggcaactattttaccggtcctggcagtatt
gcccgatcctatcgtacggcgaaaacgacgatggtggtgggtaaacagcggatgccagaa
agtcgctgctatttttatcaggatctgatgttacctgtgttactcgacagtttgcgtggc
gactggcaggccaacgaactggcgcgaccgctggcgcggctgaaaacgatggacaataac
ggcttgctgcgacgaacgctggcggcgtggtttcgccacaatgtgcaaccgctggcaacg
tcaaaggcgttgtttattcatcgtaataccctggagtatcggcttaatcgtatatcggaa
ctgaccgggcttgatttgggcaattttgatgacaggttgctgctgtatgtggcgttacaa
ctggatgaagagcggtag
              
                            

Download fasta file
RegulonDB