RegulonDB RegulonDB 10.9: Gene Sequence
yaeH gene sequence


Size: 387        A: 125  T: 90  G: 91  C: 81

Fasta

 

>yaeH E. coli K12. Version NC_000913.3 GI:556503834
atgtacgacaatctgaaaagtctgggtattaccaatcctgaagaaattgatcgttacagc
ctccggcaggaagccaacaacgatattctgaaaatctatttccagaaagacaaaggcgag
tttttcgccaagagcgttaagtttaaatatccgcgtcagcgtaaaacggtcgtcgctgat
ggtgtgggtcagggttataaagaagtccaggaaatcagcccgaatctacggtatatcatt
gatgagcttgatcaaatctgccagcgtgaccgcagcgaagttgatcttaagcgtaagatc
ctcgacgacttacgtcacctggagtcagtcgtaaccaataagatcagcgagattgaagcc
gatctggaaaaactaacgcgtaaataa
              
                            

Download fasta file
RegulonDB