RegulonDB RegulonDB 10.9: Gene Sequence
yaeI gene sequence


Size: 813        A: 182  T: 213  G: 207  C: 211

Fasta

 

>yaeI E. coli K12. Version NC_000913.3 GI:556503834
atgatttcacgccgccgatttttgcaggctactgccgcgacgatagccacgagctcaggt
ttcggttatatgcattactgtgagccaggctggtttgaattaatccgtcaccgcctcgcc
ttttttaaagacaacgcagcaccattcaaaattctttttctggccgatctccattactct
cgttttgttcctttaagcctgatttctgacgcgattgctcttggcatagaacaaaagccc
gatttgatattactgggcggcgattacgtattatttgatatgtcgctgaatttttcggcg
tttagtgacgtactctccccccttgccgaatgtgcgccgacgtttgcctgcttcggcaac
cacgatcgccctgttggtacagaaaaaaatcacttaattggcgagacgttgaaatcagcg
ggcatcacggtgttgtttaaccaggctacggtgatcgccacgccgaacaggcaattcgaa
ctggtaggcactggtgacttatgggccggacaatgcaaaccgcctcccgccagcgaagcc
aatctgccaagactggtgctggcgcataatcccgacagcaaagaagtcatgcgtgatgaa
ccctgggatctgatgctgtgcggccatactcacggcgggcaactgcgcgtaccgttggtt
ggtgaaccttttgcccctgtcgaagataaacgttacgtcgccggattaaatgcctttggc
gaaagacacatctacacaacccgtggcgtgggcagtttgtatggtttgcgtctgaactgc
cgcccggaagtaacgatgctggaactggtgtag
              
                            

Download fasta file
RegulonDB