RegulonDB RegulonDB 10.9: Gene Sequence
yagA gene sequence


Size: 1155        A: 231  T: 207  G: 377  C: 340

Fasta

 

>yagA E. coli K12. Version NC_000913.3 GI:556503834
atggagtcgcttatgccctgggatgcgagagataccatgtcattacgtactgagtttgtt
ttgttcgcctcgcaggacggggcgaacatccgttccctctgccgtcgcttcggcatttca
cctgccaccggctacaagtggctccagcgctgggctcaggaaggtgccgccggtcttcag
gaccgcccgcgcattccgcaccattccccgaaccgctcatctgacgacatcacggccctg
ctgcgtatggcccatgaccgtcatgaacgctggggagcccgcaagattaagcgctggctc
gaggaccaggggcacaccatgcccgccttcagcaccgtccataacctgatggcccgccat
ggcctgctgccgggcgcttcaccgggcattcccgccacgggccggttcgaacacgacgcg
ccgaaccgcctctggcagatggattttaagggccactttccttttggcggtggacgctgc
catccgctcaccctgctggacgaccactcccgtttttccctgtgcctggcgcactgtacc
gatgaacggcgcgagaccgtgcagcagcagctggtcagcgtgtttgagcgttacggcctg
ccggaccggatgaccatggataacggctcaccgtggggcgacaccaccggcacctggacg
gcgctggagctgtggctgatgcgcctgggtatccgggtggggcactcccggccttatcat
ccgcagacgcaggggaagctggagcgttttcaccgcagcctgaaggcggaagtgctgcag
ggaaaatggttcgcagacagcggtgaactgcagcgcgccttcgaccactggcggacggtc
tataaccttgaacgcccgcacgaggcgctggatatggcggtaccgggctcgcggtatcag
ccgtcagcgcggcagtacagcggcaacacaacgcccccggaatacgatgaaggggtgatg
gtcaggaaagtggatatcagcggaaagctgagcgtgaaaggggtaagtctgagcgcaggc
aaggcgttcaggggagaacgggtcgggctgaaggagatgcaggaagacggcagctacgag
gtgtggtggtacagcacgaaagtgggggtgatcgacctgaagaaaaagtcgatcaccatg
ggtaaaggatgttaa
              
                            

Download fasta file
RegulonDB