RegulonDB RegulonDB 10.9: Gene Sequence
yagB gene sequence


Size: 351        A: 82  T: 90  G: 92  C: 87

Fasta

 

>yagB E. coli K12. Version NC_000913.3 GI:556503834
atgaataaagactctactcaaacttgggggcttaaacgagatatcacaccgtgtttcgga
gcacgactggtgcaggaaggtcatcgtctgcattttctggctgaccgggctggattcacc
ggctcattcagtgaggtgcagactctacaactggatgaagccttcccgcattttgtcgca
catctggagctgatgctgctctcctgtgagctgaatcccaggtacgcgcactgtgtcaca
ctgtaccgtaacgggctgactggtgaagccgatacgctgggcagtcatgggtatgtatat
atcgcaattttgaatcgccacgggtttaacagacacctccgagtcatttaa
              
                            

Download fasta file
RegulonDB