RegulonDB RegulonDB 10.9: Gene Sequence
afuC gene sequence


Size: 1047        A: 231  T: 226  G: 306  C: 284

Fasta

 

>afuC E. coli K12. Version NC_000913.3 GI:556503834
atgactcagaaaaatttcgttgaactgcgcaacgtcactaaacgatttggcagtaatacg
gtaatcgacaatatcaacctcaccatcccgcaggggcaaatggtgacgctgctcggcccg
tccggctgcggcaaaaccactattttgcgcctggttgccgggctggaaaaaccgagcgaa
gggcaaattttcattgatggcgaagacgtcacccatcgctctattcagcagcgcgatatc
tgtatggtgtttcagtcctatgccctgttcccgcatatgtcgctgggagagaatgtcggt
tatggcctgaaaatgctcggcgtaccgcgcgcagagctgaaagcccgcgtcaaagaggcg
ttggcgatggtggatctggaaggattcgaagaccgctttgtcgatcagatctccggcggg
cagcagcagcgcgtggcgctggcccgcgcgctgatcctcaagccgaaagtgctgctgttt
gatgagccgttgagtaacctcgacgccaacctgcgtcgcagcatgcgcgacaagatccgc
gagttgcaaaagcagtttgatatcacctcgctgtacgtcacccacgatcagagcgaagcc
tttgcggtttctgatactgtgctggtgatgaacaagggacacatcatgcagatcggctca
ccgcaggatctttaccgccagcccgcctcccgctttatggcgagctttatgggcgatgcc
aacctgttcccggcaaccttcagcgacggatacgttgatatctacggctatcatctgccg
cgcccgctgcactttggtacacagggtgaagggatggtcggtgtgcgcccggaagcgatc
acgctcagcgatcgcggcgaagagagccagcgctgcgtgatccgccatgtcgcctatatg
gggccgcagtatgaagtgacggtggaatggcacgggcaggagatattattgcaggtcaac
gctacgcgtctgcaaccggacgtcggcgagcagtattatcttgaaatccatccgtacggc
atgtttgttctggcggatgcggcataa
              
                            

Download fasta file
RegulonDB