RegulonDB RegulonDB 10.9: Gene Sequence
rseA gene sequence


Size: 651        A: 183  T: 128  G: 167  C: 173

Fasta

 

>rseA E. coli K12. Version NC_000913.3 GI:556503834
atgcagaaagaacaactttccgctttaatggatggcgaaacgctggatagtgagctgctt
aacgaactggctcataacccagaaatgcagaaaacctgggaaagctatcacttaatccgt
gactcaatgcggggtgatactcccgaggtgctccatttcgatatctcttcacgcgtgatg
gccgccattgaagaagagccagtacgtcaaccggcgacattgatcccggaagcccagcct
gcgccgcatcaatggcagaaaatgccattctggcagaaagtacgtccgtgggcggcacag
cttacccaaatgggcgtagccgcatgcgtatcgcttgcagttatcgttggcgtccagcac
tataatggacaatctgaaacgtcccagcagcccgaaacgccggtatttaatacactgccg
atgatgggtaaagccagcccggtaagcctgggagtaccttctgaagcgaccgcaaacaat
ggtcaacagcagcaggtacaggagcagcgtcgtcgcattaatgcaatgttgcaggattac
gaactgcaacgccgactccactctgaacagcttcagtttgagcaggcgcaaacccagcaa
gccgctgtacaggtgccaggaattcaaactttaggaacgcaatcgcagtaa
              
                            

Download fasta file
RegulonDB