RegulonDB RegulonDB 10.9: Gene Sequence
ydfG gene sequence


Size: 747        A: 189  T: 180  G: 208  C: 170

Fasta

 

>ydfG E. coli K12. Version NC_000913.3 GI:556503834
atgatcgttttagtaactggagcaacggcaggttttggtgaatgcattactcgtcgtttt
attcaacaagggcataaagttatcgccactggccgtcgccaggaacggttgcaggagtta
aaagacgaactgggagataatctgtatatcgcccaactggacgttcgcaaccgcgccgct
attgaagagatgctggcatcgcttcctgccgagtggtgcaatattgatatcctggtaaat
aatgccggcctggcgttgggcatggagcctgcgcataaagccagcgttgaagactgggaa
acgatgattgataccaacaacaaaggcctggtatatatgacgcgcgccgtcttaccgggt
atggttgaacgtaatcatggtcatattattaacattggctcaacggcaggtagctggccg
tatgccggtggtaacgtttacggtgcgacgaaagcgtttgttcgtcagtttagcctgaat
ctgcgtacggatctgcatggtacggcggtgcgcgtcaccgacatcgaaccgggtctggtg
ggtggtaccgagttttccaatgtccgctttaaaggcgatgacggtaaagcagaaaaaacc
tatcaaaataccgttgcattgacgccagaagatgtcagcgaagccgtctggtgggtgtca
acgctgcctgctcacgtcaatatcaataccctggaaatgatgccggttacccaaagctat
gccggactgaatgtccaccgtcagtaa
              
                            

Download fasta file
RegulonDB