RegulonDB RegulonDB 10.9: Gene Sequence
tcyN gene sequence


Size: 753        A: 179  T: 165  G: 227  C: 182

Fasta

 

>tcyN E. coli K12. Version NC_000913.3 GI:556503834
atgagtgccattgaagttaagaacctggtgaaaaaattccacggtcagacggtgctgcac
ggtatcgaccttgaggtaaagcctggcgaagtggtggcaattatcggtccgagtggttcc
ggcaaaaccacgttgctacgcagcataaatctgctggaacaacccgaagcgggaacgatc
accgttggcgatatcactattgatactgcacgttcattaagtcagcaaaaatctctgatt
cgccagttgcgtcagcacgtcgggtttgtcttccagaactttaatttgtttccgcatcgt
acggtgctggagaacattattgaagggccggtgatcgtcaaaggtgaaccgaaagaagag
gccacggcgcgcgctcgcgagctgctggcaaaagttgggctggcaggtaaagaaaccagc
tatccacgtcgtttgtctggcggtcaacagcagcgtgttgcgattgcgcgtgcgctggca
atgcgtcctgaggtgattttgtttgacgagccaacgtcagcgctggatccagagctggtg
ggtgaagtcctgaacaccatccgtcagctggcgcaggaaaagcgcacgatggtgattgtg
acgcacgaaatgagctttgcccgggatgttgcggaccgggcgatctttatggaccagggg
cggatagtcgagcagggggccgcaaaagcgttatttgccgaccccgagcagcctcgcacc
cgccagttcctcgagaagtttctgctgcaataa
              
                            

Download fasta file
RegulonDB