RegulonDB RegulonDB 10.9: Gene Sequence
arfB gene sequence


Size: 423        A: 113  T: 81  G: 120  C: 109

Fasta

 

>arfB E. coli K12. Version NC_000913.3 GI:556503834
atgattgtgatttcccgacatgttgctattcccgatggtgagcttgagatcaccgccatt
cgtgcgcagggcgcgggcgggcagcatgttaataagacctcaacggctattcatctgcgt
tttgacattcgggcgtccagcctgccagagtattacaaagagcgtctgctcgccgccagc
catcatttgatcagcagtgatggcgtgattgtcattaaggcacaggaataccgcagtcag
gaactgaaccgcgaagcagctctggcccggctggtggctatgattaaagaattaacaaca
gaaaaaaaagcccgacgacccacgcggcccacccgtgcatcgaaagagcgcaggctggca
tcgaaagcacaaaaatcaagcgtgaaggcgatgcgcggcaaagtgcgcagcggtcgggaa
taa
              
                            

Download fasta file
RegulonDB