RegulonDB RegulonDB 10.9: Gene Sequence
yfaE gene sequence


Size: 255        A: 51  T: 61  G: 74  C: 69

Fasta

 

>yfaE E. coli K12. Version NC_000913.3 GI:556503834
atggcccgcgttaccctgcgcatcactggcacacaactgctgtgccaggatgaacaccct
tcccttctggcggcgctggaatcccacaatgtggcggttgagtaccagtgtcgcgaaggt
tactgcggctcctgtcgcacacgcctggttgcaggtcaagttgactggattgccgaaccg
ttagcctttattcagccgggggaaattttgccctgttgttgccgggcaaaaggcgatatt
gaaatcgagatgtga
              
                            

Download fasta file
RegulonDB