RegulonDB RegulonDB 10.9: Gene Sequence
znuB gene sequence


Size: 786        A: 125  T: 253  G: 248  C: 160

Fasta

 

>znuB E. coli K12. Version NC_000913.3 GI:556503834
atgattgaattattatttcccggttggttagccgggatcatgctcgcctgtgccgcgggt
ccgctgggttcgtttgtagtctggcgtcgtatgtcttatttcggtgatacgctggctcat
gcctcattacttggcgtcgcgtttggtttgttgctggacgtgaatccattctatgcggtg
attgccgttacgctgctgctggcgggcggtctggtatggctggagaagcgtccacagctg
gcgatcgacacgttattagggattatggcgcacagtgccctgtcgctgggcctggtggtc
gtgagtctgatgtctaatattcgtgttgatttgatggcttacctgttcggtgatttgctg
gcagtgacgccagaagatctcatctctattgcgattggcgtggtcatcgtggtggctatt
ttgttctggcaatggcgcaatttgctgtcaatgacgataagcccggatctggcgtttgtt
gatggtgtgaaattacagcgagtgaaattgttgttgatgctggtgacggcattgacgatt
ggtgtagcgatgaaatttgtcggtgcgttgattattacttcgttgctgattattcctgct
gctactgcgcgtcgctttgcccgcacgccggaacagatggctggtgtcgctgttttggtg
gggatggtggcagtgactggcggtttaaccttttccgcggtttacgatacgccggcgggt
ccgtcggtggtgctatgtgcggcactgttatttattctcagtatgatgaaaaagcaggcc
agctaa
              
                            

Download fasta file
RegulonDB