RegulonDB RegulonDB 10.9: Gene Sequence
ydjE gene sequence


Size: 1359        A: 292  T: 454  G: 342  C: 271

Fasta

 

>ydjE E. coli K12. Version NC_000913.3 GI:556503834
atggaacaatatgatcaaattggcgcaagactggaccgcttgcctttggcccggtttcat
tatcgtatatttggtattataagctttagtctgttattaacagggtttttgagttactcc
ggtaatgtcgtcttagcaaagctggtaagcaatggatggtcaaataatttcctcaatgcc
gcctttacctcggcattaatgtttggttatttcatcggctcacttactggtgggtttatt
ggtgactactttgggcggcgcagggcgtttcgcataaatcttctcatcgtcggtattgct
gcaacaggggccgcttttgtccctgatatgtactggctcatcttctttcgcttcctgatg
ggaacaggaatgggggcgctgattatggttggctatgcctcatttacggagtttatcccc
gcgacggtgcgtggaaaatggtccgcgcggctctcatttgttggtaactggtcgcccatg
ctgtctgcggcgataggcgtggtggttatcgctttttttagttggcgaataatgtttctg
ctgggtggtattggcatactgttagcctggtttctctcaggtaaatactttatcgagtcg
ccacgatggctggcagggaaagggcaaatcgcaggtgcagaatgccaacttcgtgaagta
gagcagcaaattgaaagagagaagagtattcgtttacccccgcttacttcgtatcagagc
aacagcaaggttaaagtaatcaagggtactttctggctcctgtttaaaggtgaaatgtta
cgacgtacattagtcgcgattactgttttaattgcaatgaacatttcgctttataccatc
accgtatggataccgaccatatttgttaactccggcattgatgtcgataaatcaatatta
atgaccgctgttattatgattggcgctccggtaggaatatttattgcggcattaattatt
gatcattttcctcgtcggttatttggctccaccttacttattattattgccgtgttaggc
tatatctattcaattcagactacagagtgggcgattttaatctatggactggtgatgatc
ttctttttatacatgtatgtttgcttcgcgtcggcggtttatatcccggagctttggcca
acgcatttacgcctgcgcggttcgggtttcgttaatgccgtcggacggatcgtcgcagtc
ttcacgccctatggcgttgcggcattattaacacattatgggtcgatcacggtgtttatg
gtacttggtgttatgttattgctctgtgcgctggttctctccatttttggcatcgaaacg
cggaaggtgtcgttggaagagatttctgaggtgaattaa
              
                            

Download fasta file
RegulonDB